haplogroup g origin

Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. Ann Hum Genet 2008; 72: 205214. New insights into the Tyrolean Icemans origin and phenotype as inferred by whole-genome sequencing. Proc Natl Acad Sci USA 2011; 108: 97889791. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. Its age is between 7,700 and . The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. ), Haplogroup M, as of 2017, is also known as K2b1b. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Haplogroup G is a branch on the maternal tree of human kind. The discovery of new SNPs can result in assignment of new names to haplogroup categories. [2], In 2012, a paper by Siiri Rootsi et al. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. Am J Hum Genet 2001; 68: 10191029. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. See: Poznik. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. [5] Cinnioglu et al. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. See more. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Eur J Hum Genet 2007; 15: 485493. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Another notable feature is its uneven distribution. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. Haplogroup LT (L298/P326) is also known as Haplogroup K1. Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. Google Scholar. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. P287 was identified at the University of Arizona and became widely known in late 2007. Artefactual values below 0% values were not depicted. Russ J Genet 2004; 40: 326331. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. Encyclopedia of mtDNA Origins - Discover your maternal lineage. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. Nasidze I, Quinque D, Dupanloup I et al. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Am J Hum Genet 2008; 82: 873882. AAL thanks the Sorenson Molecular Genealogy Foundation. There are multiple SNPs which so far have the same coverage as P15. Article A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. The mutations involved may be complicated and difficult to interpret. Luis JR, Rowold DJ, Regueiro M et al. Interestingly, the decrease of hg G frequency towards the eastern European populations inhabiting the area adjacent to NW Caucasus, such as southern Russians and Ukrainians,18, 40 is very rapid and the borderline very sharp, indicating that gene flow from the Caucasus in the northern direction has been negligible. Parallel evolution of genes and languages in the Caucasus region. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. The genome-wide structure of the Jewish people. Internet Explorer). [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. [43] L240 was identified in 2009. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Human Y chromosome DNA grouping common in western Eurasia, This article is about the human Y-DNA haplogroup. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in Mol Phylogenet Evol 2007; 44: 228239. Hum Hered 2006; 61: 132143. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. Article There are seeming pockets of unusual concentrations within Europe. In contrast to its widely dispersed sister clade defined by P303, hg G-M406 has a peak frequency in Cappadocia, Mediterranean Anatolia and Central Anatolia (67%) and it is not detected in most other regions with considerable P303 frequency. Am J Hum Genet 2004; 74: 10231034. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. (2000) suggested 17,000 years ago. Haplogroup H IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Please help update this article to reflect recent events or newly available information. In other words, these mutations are so unique that they could only come from other cells with the same mutations. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. Concerning the presence of hg G in the Caucasus, one of its distinguishing features is lower haplogroup diversity in numerous populations (Supplementary Table S1) compared with Anatolia and Armenia, implying that hg G is intrusive in the Caucasus rather than autochthonous. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. Even more G SNPs were identified in 2009 to 2012 leading to more changes. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. More distantly, G2a3a-M406 occurs in Italy (3%) with a Td of 8100 years ago, consistent with the model of maritime Neolithic colonization of the Italian peninsula from coastal Anatolia and/or the Levant. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. Eur J Hum Genet 2003; 11: 535542. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. [citation needed] (2004) suggested the mutation took place only 9,500 years ago. It is provided at the request of readers. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. We attempted to localize the potential geographic origin of . The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. Hum Genet 2004; 114: 127148. His male-line descendants appear to remained rooted in the region for tens of thousands of years while the Ice Age was in full swing. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . Kayser M, Caglia A, Corach D et al. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. Pichler I, Fuchsberger C, Platzer C et al. Eur J Hum Genet 2004; 12: 855863. The second component, influenced by the relatively high presence of M377, separates Ashkenazi Jews from other populations (Figure 3a). The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). International Society of Genetic Genealogy (ISOGG; 2015), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences", https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1139571590, Articles with dead external links from January 2020, Articles with permanently dead external links, All articles with bare URLs for citations, Articles with bare URLs for citations from April 2022, Articles with spreadsheet file bare URLs for citations, Short description is different from Wikidata, Articles with self-published sources from October 2020, Articles with unsourced statements from November 2017, Articles with unsourced statements from September 2022, Articles with unsourced statements from July 2017, Wikipedia articles in need of updating from February 2021, All Wikipedia articles in need of updating, Creative Commons Attribution-ShareAlike License 3.0, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 15 February 2023, at 20:17.

Remitly Software Engineer Interview, Boron Superhero Powers, Lancaster Jethawks Schedule, Is Bubba Smith From Storage Wars Married, Post Hotel Leavenworth Wedding, Articles H